snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70D
sequence
CTGCAGACAGTTAAGCCAACTGAGTTCCTTTCCTCAGGGAGGCCCAGTGTACAATGGCT
GCCCACAGCAGCTTCCTTGGTAGCGTACTCAGCCTGTTTCTTGTATGGGTTGCTCTAAGG
GACCTTAGAGACAGGC
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA70D
alias U70D
chromosome ⁄ contig 16
locus ⁄ host gene PHLPPL
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1692
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved