snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD111B
sequence
CAGCCTGAAGTGATGATTCACATTCATGTCTCTTCTCTGATAAATTCTTGAAGAAAATT
TTTGTGTGTCTGATCAGGCCT
  Box motif
  Complementary to target RNA
length 80
organism Homo_sapiens
snoRNA name SNORD111B
alias HBII-82B
chromosome ⁄ contig 16
locus ⁄ host gene SF3B3
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G3923
accession no AM413027
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved