snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA50
sequence
AAGCACTGCCTTTGAACCTGATGTGTCTTGTTTGTAGCTTCACGGGCCAAGCAACAGTG
CTAGAGCATAACGACTTGTTATAACTGGGGCTCTTCAGCTCTCAACTGAACTGCTCTTTT
AAAAACAAGGTACATTT
  Box motif
  Complementary to target RNA
length 136
organism Homo_sapiens
snoRNA name SNORA50
alias ACA50
chromosome ⁄ contig 16
locus ⁄ host gene CNOT1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U34,18S:U105
accession no AJ609468 NT_010498
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved