snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA80
sequence
GCATGGGTTTGGATTTATGATGGGCTGGATTCCCTAGGCCTCTCATAGTACCCCATGCC
AGAGCAAACTGTAGCCCCAACCATTGCCGGGCCTCTATGCCTGTAGGCTGCTGGCACTGA
AGTGGGTTGCACAGTA
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA80
alias
chromosome ⁄ contig 16
locus ⁄ host gene ZNF688
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U109,18S:U572
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved