snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA30
sequence
CTGGCACTTTCACAGTTCCTTCCCCAGGCAGTGGGGCCAGGATTTGGTAGCTGGTGCTG
AGAGAAAACCCTTGATTGTATTCTTGCCCTGGGATTATACCAGTGGCAACTGTCACTCAA
TGGGACAGTG
  Box motif
  Complementary to target RNA
length 129
organism Homo_sapiens
snoRNA name SNORA30
alias ACA30
chromosome ⁄ contig 16
locus ⁄ host gene TAOK2
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4643
accession no AJ609440 NT_010393
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved