snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA64
sequence
ACTCTCTCGGCTCTGCATAGTTGCACTTGGCTTCACCCGTGTGACTTTCGTAACGGGGA
GAGAGAGAAAAGATCTCCTCAGGACCTCGGATGGGCCTTACTGTGGCCTCTCTTTCCTTG
AGGGGTGCAACAGGC
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA64
alias U64
chromosome ⁄ contig 16
locus ⁄ host gene RPS2
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4975
accession no Y11158 NT_010393
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved