snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA10
sequence
GGTCTCTCAGCTCCGCTTAACCACACGGGTCCAGTGTGTGCTTGGCGTGTTTTCAGGGA
GGCAGAGAAAGGCTCTCCTAATGCACGACAGACCCGCCCAGAATGGCCTCTCTGTTCCTA
GGAGTGCGACAATT
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORA10
alias ACA10
chromosome ⁄ contig 16
locus ⁄ host gene RPS2
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type H/ACA
modification site 18S:U210,28S:U4491
accession no AJ609432 NT_010393
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved