snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD62BL1
sequence
TCTTAGTGACATAATTCTAATAGTTTGTTCCGACCTTCCACTGTGGACTCAATAGCAGG
GAGATGAAGAGGACAGTGATTGCATGA
  Box motif
  Complementary to target RNA
length 86
organism Homo_sapiens
snoRNA name SNORD62BL1
alias
chromosome ⁄ contig 9
locus ⁄ host gene MAN1B1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved