snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD36C
sequence
TTGCCAATGATGGTTAAGAATTTCTTCACCTGAATAAACCATGTGGTCAGCATTGCATC
TGAGGCAAA
  Box motif
  Complementary to target RNA
length 68
organism Homo_sapiens
snoRNA name SNORD36C
alias U36C
chromosome ⁄ contig 9
locus ⁄ host gene RPL7A
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3703
accession no X97587,NR_000016,NT_035014
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved