snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD36A
sequence
TTGCAATGATGTGAATCTCTCACTGAATTCAACCTTGAAGTGCGAATCCATGAGCTTTT
TAACCCTGAGCAA
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD36A
alias U36A
chromosome ⁄ contig 9
locus ⁄ host gene RPL7A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A668
accession no X97584,NT_035014
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved