snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD36B
sequence
TTGCAGTGATGTAAAATTTCTTGGCCTGAAATTACTGTGAAGAGTAAAACCGAGCTTTT
TAACACTGAGTCAG
  Box motif
  Complementary to target RNA
length 73
organism Homo_sapiens
snoRNA name SNORD36B
alias U36B
chromosome ⁄ contig 9
locus ⁄ host gene RPL7A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:A668
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved