snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA65
sequence
TCAGCCACCCGCCACTGCACCTGACCAGGTCTCTGTTGGCTGGTGCAATCCAGTGGTGA
GCTGATAGTAAACCCCAGCTTAGGAAACAGGGTTGTTCTTCATGTGGATGACTCTGTGCC
GAAAGCATGGGAACAGCC
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA65
alias U65
chromosome ⁄ contig 9
locus ⁄ host gene RPL12
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4373,28S:U4427
accession no Y11159 NT_008470
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved