snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD90
sequence
AAGTTTTCTAAGTGTCTAATGATGAATTTCATAGGGCAGATTCTGAGGTGAAAATTTAA
TTCATCACTGATACTCCTACTGTGGAATCTGAAGACACTTGAAAACGT
  Box motif
  Complementary to target RNA
length 107
organism Homo_sapiens
snoRNA name SNORD90
alias HBII-295
chromosome ⁄ contig 9
locus ⁄ host gene RC3H2
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no NR_003071,NT_008470
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved