snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA70C
sequence
CTGCAGCCAATTAAGCCAACTGGGTTCCTTTCCTCATGGGGGCCCATTGTGCAATGGCT
GCAAACAGCAGCTTTCTTGGTAGTGTATGCAGCCTGTTTGTTGTATGGGTTGCTTTAAGG
GACCATGGAAACAGGC
  Box motif
  Complementary to target RNA
length 135
organism Homo_sapiens
snoRNA name SNORA70C
alias U70C
chromosome ⁄ contig 9
locus ⁄ host gene ASTN2
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1692
accession no AM413015
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved