snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD3@(U3.37-201)
sequence
AAGATGACACTTTGAGGCATCGTGTCTATGGTTCATTACTACAGAAGCTTCTCTGGATG
TGTAAAGCACAGGAAACCAGGCAGAGGAGGCACAGGGTGCTCTCCAGAACGAGAAGCCAG
CTCCTGGAGTTGTTTGCTGCAACTGCCATTCCCCGTTGATGACCATGCTCTTCCTTCAGA
AGAGGGAGAGTGAGAGGACCAAGTCCAAGTGG
  Box motif
  Complementary to target RNA
length 211
organism Homo_sapiens
snoRNA name SNORD3@(U3.37-201)
alias
chromosome ⁄ contig 19
locus ⁄ host gene SIGLEC11
organization Intronic
target RNA
modification type unknown
modification site
accession no AC011452.6
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved