snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD34
sequence
CGTCCATGATGTTCCGCAACTACCTACATTGTTTGATCCTCATGAAAGCAGCACTGGCT
GAGACGC
  Box motif
  Complementary to target RNA
length 66
organism Homo_sapiens
snoRNA name SNORD34
alias U34
chromosome ⁄ contig 19
locus ⁄ host gene RPL13A
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:U2824
accession no NR_000019,NT_011109
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved