snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD33
sequence
GGCCGGTGATGAGAACTTCTCCCACTCACATTCGAGTTTCCCGACCATGAGATGACTCC
ACATGCACTACCATCTGAGGCCAC
  Box motif
  Complementary to target RNA
length 83
organism Homo_sapiens
snoRNA name SNORD33
alias U33
chromosome ⁄ contig 19
locus ⁄ host gene RPL13A
organization Intronic
target RNA 18S rRNA
modification type C/D
modification site 18S:U1326
accession no NR_000020,NT_011109
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved