snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA68
sequence
TTCTCACCTAAACCCAAGAATCACTGTTTCTTATAGCGGTGGTTTAAACAGAGGTGCAA
ACAGCAAGTGAATCTCGTCGCCTTTGCGGGGCTGTGGCCATGCCCCTCAAAGGAAATTTG
GAGGCTCTACAGCC
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORA68
alias
chromosome ⁄ contig 19
locus ⁄ host gene ANKRD27
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4393
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved