snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD37
sequence
ATTCGTGATGACTGATCATTTCTTCACTTTGACCAGATGTCTACTGAAGAAAGCCTGCG
TCTGAGG
  Box motif
  Complementary to target RNA
length 66
organism Homo_sapiens
snoRNA name SNORD37
alias U37
chromosome ⁄ contig 19
locus ⁄ host gene EEF2
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3697
accession no NR_002602,NT_011255
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved