snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD96A
sequence
CCTGGTGATGACAGATGGCATTGTCAGCCAATCCCCAAGTGGGAGTGAGGACATGTCCT
GCAATTCTGAAGG
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD96A
alias U96a
chromosome ⁄ contig 5
locus ⁄ host gene GNB2L1
organization Intronic
target RNA 5.8S rRNA
modification type C/D
modification site 5.8S:G75
accession no AY349595,NT_023133
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved