snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA74B
sequence
TTTCCAGCAGTAGTCAGCCATCCGGACAGAACCGTTCCTGTGATGGTGTTACACTGCTG
GGAGAGGAATGTCTTGTCTTCATCCGGTTGCCTGCGCCACTGTTCTGGTGGCGTCTGGCA
CTGGTGCAAGACAGAGCTGTGCTTCCCCGAGAGTGTGCTAAGCATTCACTTTGGCTGCTT
AGTTCTAGTCTGGGAGCAGACAGAG
  Box motif
  Complementary to target RNA
length 204
organism Homo_sapiens
snoRNA name SNORA74B
alias U19-2
chromosome ⁄ contig 5
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U3741,28S:U3743
accession no AM055743
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved