snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA57.1-201
sequence
CCTCGCTTTCTTTGCAGGGAGCAGGTATGTATGTTCCCTATTATGTCTGGAGGCAGAGG
GAAAAGGCTTCAGTCCCCTGGGCATCATGTCTTTGGTGCCGCTGGCTTCCTGTCTGCCAA
TTCTATCCTCAAGCACTGGGACACAG
  Box motif
  Complementary to target RNA
length 145
organism Homo_sapiens
snoRNA name SNORA57.1-201
alias
chromosome ⁄ contig 5
locus ⁄ host gene UBTD2
organization Intronic
target RNA
modification type unknown
modification site
accession no AC024561.5
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved