snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA74A
sequence
ATCCAGCGGTTGTCAGCTATCCAGGCTCATGTGGTGCCTGTGATGGTGTTACACTGTTG
GAAGAGCAAACACTGTCTTTATTGAGGTTTGGCTCCAAGCACTGTTTTGGTGTTGTAGCT
GAGTACCTTTGGGCAGTGTTTTGCACCTCTGAGAGTGGAATGACTCCTGTGGAGTTGATC
CTAGTCTGGGTGCAAACAATT
  Box motif
  Complementary to target RNA
length 200
organism Homo_sapiens
snoRNA name SNORA74A
alias U19
chromosome ⁄ contig 5
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site 28S:U3741,28S:U3743,U3:U8
accession no X94290,NT_034772
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved