snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD63
sequence
GTGCAATGATGTATTTTATTCAACACATCATTCTGAAAGAACGTGTGGAAAACTAATGA
CTGAGCACA
  Box motif
  Complementary to target RNA
length 68
organism Homo_sapiens
snoRNA name SNORD63
alias U63
chromosome ⁄ contig 5
locus ⁄ host gene HSPA9B
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A4541
accession no U72852,NT_034772
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved