snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA51
sequence
GGCCTCCTGGTGCTTACAAGCAGCTGTGTGCTTGCATTGACTGTACAGAAAAAAAGAGA
TAGAGTAAACACACCCCGTATACAACTCAGCCCAGGTCCTGTGCCTTGTCTATATTGTGA
ATAGGGGGGACATAG
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA51
alias
chromosome ⁄ contig 5
locus ⁄ host gene AC012622.6
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved