snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA57
sequence
CCTCCTTTTCTTGTCAGGGACTGAGTGTGTGGTCCTGCTCCTGTTATGTATGGAGGCAA
AGGGAAAGGGCTCCGGCCCCCTCAAAATCATGTCTTTGGTGCCAGCCGGTTCTGTTCTCA
GTCACCTGG
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name SNORA57
alias
chromosome ⁄ contig 5
locus ⁄ host gene PRKAA1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1004
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved