snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD73A
sequence
AATAAGTGATGAAAAAAGTTTCGGTCCCAGATGATGGCCAGTGATAACAACATTTTTCT
GATGTT
  Box motif
  Complementary to target RNA
length 65
organism Homo_sapiens
snoRNA name SNORD73A
alias U73a
chromosome ⁄ contig 4
locus ⁄ host gene RPS3A
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:G1747
accession no NR_000007,NT_016354
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved