snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD73B
sequence
AATGAATGATGACAAAATGTTTCAGTCCCAAATGATACATACTGATTATACCATTATAT
TTATCCTGACATT
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD73B
alias U73b
chromosome ⁄ contig 4
locus ⁄ host gene RPS3A
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved