snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA29
sequence
TTTCTCATTTGACTACCACATTTTCTCCTAATAATAGATTTTAGTGGCTATGCTTATGG
GATAGATTAAACTTGCCATGATCTGAAGAGGGAGGGTTTTTTCATGTCCTCCTCCTATAT
GAAATGGCTGAACGGATATTA
  Box motif
  Complementary to target RNA
length 140
organism Homo_sapiens
snoRNA name SNORA29
alias ACA29
chromosome ⁄ contig 6
locus ⁄ host gene TCP1
organization Intronic
target RNA Unknown
modification type H/ACA
modification site
accession no NR_002965 NT_025741
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved