snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA20
sequence
CTTCCCATTTATTTGCTGCTTGTAGTCTCACAGTGATACGAGCAGTTATACGCATGGGA
TAAAATAACATTGGGCCACTGTAAATTGAGATGAAGTAACCATTTTCATCTCTTCTGCAG
GGACTAGACATTG
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA20
alias ACA20
chromosome ⁄ contig 6
locus ⁄ host gene TCP1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U651
accession no AJ609459 NT_025741
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved