snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA33
sequence
AAGCCAGCCAATGAATCTGCTTACCTGATTGTGTTTGTGCAGACATACTTTAAAAACTG
GCAATAGTAAAGCCATGTTACGAGCCTTAAGGACATTGAAGTCGTTAAGGTCCCTGAGAA
TGGCTATAACAAAT
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORA33
alias ACA33
chromosome ⁄ contig 6
locus ⁄ host gene RPS12
organization Intronic
target RNA 28S rRNA
modification type H/ACA
modification site 28S:U4966
accession no AJ609473 NT_025741
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved