snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD50B
sequence
AATCAATGATGAAACCTATCCCGAAGCTGATAACCTGAAGAAAAATAAGTACGGATTCG
GCTTCTGAGAT
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD50B
alias U50B
chromosome ⁄ contig 6
locus ⁄ host gene small nucleolar RNA host gene 5
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 Medical Biology, Faculty of Medicine, University of Miyazaki, All rights reserved