snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA38
sequence
TCCTCCTACAAAGGCGTGTCTGTGGTTCCCTGTCTTTGGACACGTAAGAATTGGAGGAA
AATAAATGTGGATTTGGGAAACTTTGAGGCCAGCTTGCTTCTTGCAGGCTCATGATCAAC
CAATCTCACATAA
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA38
alias ACA38
chromosome ⁄ contig 6
locus ⁄ host gene
organization Intronic
target RNA
modification type H/ACA
modification site
accession no NR_002971 NT_167248
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved