snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD16
sequence
TTGCAATGATGTCGTAATTTGCGTCTTACTCTGTTCTCAGCGACAGTTGCCTGCTGTCA
GTAAGCTGGTACAGAAGGTTGACGAAAATTCTTACTGAGCAA
  Box motif
  Complementary to target RNA
length 101
organism Homo_sapiens
snoRNA name SNORD16
alias U16
chromosome ⁄ contig 15
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site 18S:A484
accession no NR_002440,NT_010194
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved