snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD118
sequence
TAGTCAGGCGGGATAATCCTTACCTGTGCCTCCTTTTGGAGGGCAGCAGAATGTGGTAG
TTGGAGTTGCATGATACTTGATTCATATCTCTGTGTAATGATGGCATGCAATACCCTGAC
TGCTCCTTTCGAAT
  Box motif
  Complementary to target RNA
length 133
organism Homo_sapiens
snoRNA name SNORD118
alias
chromosome ⁄ contig 15
locus ⁄ host gene CHRFAM7A
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site Processing
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved