snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD116-13
sequence
GGACCAATGATGACTTCCATACATGCATTCCTTGGAAAGCTGAACAAAATGAGTGGGAA
CTCTGTACTATCATCTTAGTTGAACTGAGGTCC
  Box motif
  Complementary to target RNA
length 92
organism Homo_sapiens
snoRNA name SNORD116-13
alias HBII-85-13
chromosome ⁄ contig 15
locus ⁄ host gene hmm16326423
organization Intronic
target RNA Unknown
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved