snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA75
sequence
GTCTTCTCATTGAGCTCCTTTCTGTCTATCAGTGGCAGTTTATGGATTCGCACGAGAAG
AAGAGAGAATTCACAGAACTAGCATTATTTTACCTTCTGTCTTTACAGAGGTATATTTAG
CTGTATTGTGAGACATTC
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORA75
alias U23
chromosome ⁄ contig 2
locus ⁄ host gene NCL
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U93
accession no AJ007015,NT_005403
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved