snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA41
sequence
TTCCACAGCTACTGGTCTGCAGCTGTTCTTATGGTAGCAGTTGTGGCATTCCTCTGTGG
GAAAGAAACTGTTAACACAAACACCTCTTTCTTAGCAAAACAGAAAGTGGGTATATATGT
GTGACAGACACAA
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA41
alias ACA41
chromosome ⁄ contig 2
locus ⁄ host gene EEF1B2
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1643
accession no AJ609464 NT_005403
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved