snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD51
sequence
GTTGCATGATGAATAAAATCAAATCACCATCTTTCGGCTGAGTTCGTGATGGATTTGCT
TTTTTCTGATT
  Box motif
  Complementary to target RNA
length 70
organism Homo_sapiens
snoRNA name SNORD51
alias U51
chromosome ⁄ contig 2
locus ⁄ host gene EEF1B2
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A1511
accession no X96650,NR_002589,NT_005403
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved