snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA40
sequence
TGCACTTATGTATGTTTTTGTTTAACTTGTGGACAAAGACTTATGGATAGGTGCAAAAA
ATAAATCCTCTTTTGCAACCCAGAACTCATTGTTCAGTATGAGTTTTGATACATATAAGA
AGGGATATT
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name SNORA40
alias
chromosome ⁄ contig 2
locus ⁄ host gene RAB3GAP1
organization Intronic
target RNA 18S rRNA, 28S rRNA
modification type H/ACA
modification site 28S:U4546,18S:U1174
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved