snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD94
sequence
caggctgtgatgattggcgcaggggtacggacctcagctgagtcatgggagctgaatgt
atgtgtttctcctttgtcctgcatgtggcaggctgatggggagcacttacatgagactgt
tgcctcaatctgagcctg
  Box motif
  Complementary to target RNA
length 137
organism Homo_sapiens
snoRNA name SNORD94
alias U94
chromosome ⁄ contig 2
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site U6:C62
accession no AY349593,NT_022184
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved