snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA36C
sequence
TTCCAAAGTGTTGAGTTCAGTCCAGGGCAGCTTCCCTGTTCTGTTAATTAAACTTTGGG
ACATTGAAATGGGCTAGGGGAGATGATTGGGTAGAAAGCATTATTTTATTCATTTGCCTC
CCAGCCTACAAAA
  Box motif
  Complementary to target RNA
length 132
organism Homo_sapiens
snoRNA name SNORA36C
alias
chromosome ⁄ contig 2
locus ⁄ host gene AAK1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1244
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved