snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD53L1
sequence
TTGCTGTGATGACTATCATTGGGTTTCGCATGTTGCTGAGTTCCAGTGATGCCTCTTTT
CTCTTGGCTGTCTGAGCAA
  Box motif
  Complementary to target RNA
length 78
organism Homo_sapiens
snoRNA name SNORD53L1
alias
chromosome ⁄ contig 2
locus ⁄ host gene WDR43
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved