snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD92
sequence
TGGTGCTGTGATGATGCCTTAATATTGTGGTTTCGACTCACTGAGAGTAAAATGAGGAC
CTACAATTCCTTGGCTGTGTCTGAGCACCC
  Box motif
  Complementary to target RNA
length 89
organism Homo_sapiens
snoRNA name SNORD92
alias HBII-316
chromosome ⁄ contig 2
locus ⁄ host gene WDR43
organization Intronic
target RNA 28S rRNA
modification type C/D
modification site 28S:A3846
accession no NR_003074,NT_022184
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved