snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA80B
sequence
GCATGGGTTTGGATTTATGACAGGCCCGTCACCCTGGGCCTGTCATAGTACCCCATGCC
AGAGCAAACTGTGTCCCCGAACCATTGCCTGGCCTCTGTGCCCGTAGGCTGCTGGCACTG
AAGTGGGTTGCACAGTG
  Box motif
  Complementary to target RNA
length 136
organism Homo_sapiens
snoRNA name SNORA80B
alias ACA67B
chromosome ⁄ contig 2
locus ⁄ host gene ODC1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U109,18S:U572
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved