snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA60
sequence
CACCTGCATTCAAAAATGATCACGGGCTGCCTGTGCTCTGGTCATCAATAACGCAGGGA
GAGGAATTGCTGAAAGCCGTTTCCCGTGTTTGGAGGGTTCACACCTGTCCCTTTCAAATG
CTGGCGCTTTCACACAC
  Box motif
  Complementary to target RNA
length 136
organism Homo_sapiens
snoRNA name SNORA60
alias ACA60
chromosome ⁄ contig 20
locus ⁄ host gene C20orf198
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U1004
accession no AJ609469 NT_011362
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved