snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORA71D
sequence
ACCTGTATTCGAAAGTGATCGTGGGCTGCCTGTGCCCTGGTCATTGATAGTGCAGGGAA
AGAAATCGCGGAAAGTGCTTCCCCGTGTTTGGAGGGTCCGCTCCTGTCCCTTTCAAACTC
TGGAGCTTTCTCACA
  Box motif
  Complementary to target RNA
length 134
organism Homo_sapiens
snoRNA name SNORA71D
alias U71d
chromosome ⁄ contig 20
locus ⁄ host gene AL080249.26
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site 18S:U406
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved