snOPY snoRNA Orthological Gene Database
Homo_sapiens AL080249.26
sequence
TCTTGTATCCAAAAGTGATCATGGGTTGCCTGTGTCCCGATCATTAACAGTGCAGGGGT
AGGAGTGCTGAAAGACATCTTCCCTGCGTTGGTCCAGCCTTCCCTTTCAAACCCTGGAGC
TTTCCCACG
  Box motif
  Complementary to target RNA
length 128
organism Homo_sapiens
snoRNA name AL080249.26
alias
chromosome ⁄ contig 20
locus ⁄ host gene AL080249.26
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved