snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD56L1
sequence
CTAAAACAATGTCAATAGTTTTCATCAACAGCAGTTGAACCTAGTAAGTGTCGATACTT
TGGGTCTGAGTGG
  Box motif
  Complementary to target RNA
length 72
organism Homo_sapiens
snoRNA name SNORD56L1
alias
chromosome ⁄ contig 20
locus ⁄ host gene EDEM2
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved