snOPY snoRNA Orthological Gene Database
Homo_sapiens SNORD17
sequence
GTGAAATGATGATTCAGTTTATCCATTCGCTGAGTGCGCTGCACTGACCTTCTTCCAAG
CCTCAGTTCCTGTTCTAGGAACTTGAGGCTATGTAGCCTGAAAATGCCCTGCAGTCTGCA
GTGTTCTACTGTGAACTGCTTGTGTGTTGGCAGGCTACCGGTAAGAATGGTTGGTGTCAG
CAGGGACGGGGCCCTCTGAGACCCATCTCACAAAGATGAGTGGTGAAAATCTGATCAC
  Box motif
  Complementary to target RNA
length 237
organism Homo_sapiens
snoRNA name SNORD17
alias HBI-43
chromosome ⁄ contig 20
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site 28S:U3797
accession no NR_003045,NT_011387
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved